Gene name |
SPAC14C4.13 |
Gene ID |
26/G07 |
Gene synonyms/obsolete |
rad17 |
Gene product |
involved in DNA damage
checkpoint; involved in DNA replication checkpoint; RFC
related; involved in DNA repair; involved in double-strand
break repair |
Entry clone |
Cloned |
ORF length (unspliced) |
1921 |
ORF length (spliced) |
1821 |
Entry clone length |
1921 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
242A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC14C4.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCGACAGTTGTCGTT |
Rev primer name |
SPAC14C4.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTTCATCTTCAATCGGA |
Amino acid length |
606 |
Molecular weight |
68.8 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
16 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTDSLESRLLL/LRSAINSLQL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |