| Gene name |
SPAC14C4.13 |
| Gene ID |
26/G07 |
| Gene synonyms/obsolete |
rad17 |
| Gene product |
involved in DNA damage
checkpoint; involved in DNA replication checkpoint; RFC
related; involved in DNA repair; involved in double-strand
break repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1921 |
| ORF length (spliced) |
1821 |
| Entry clone length |
1921 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
242A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC14C4.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCGACAGTTGTCGTT |
| Rev primer name |
SPAC14C4.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTCATCTTCAATCGGA |
| Amino acid length |
606 |
| Molecular weight |
68.8 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
16 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTDSLESRLLL/LRSAINSLQL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |