| Gene name |
SPBC1703.12 |
| Gene ID |
26/F04 |
| Gene synonyms/obsolete |
nbp9 |
| Gene product |
ubiquitin C-terminal
hydrolase activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1908 |
| ORF length (spliced) |
1758 |
| Entry clone length |
1908 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1635T:C /
1638C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1703.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCTGCTTCGTTGGAT |
| Rev primer name |
SPBC1703.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTTTTGGAACGGCTTCTA |
| Amino acid length |
585 |
| Molecular weight |
66.7 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
301/579 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKILSLHL |
| Localization (YFP) |
periphery at site of
septum formation; nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol) |
| Microscope used for
observation |
DeltaVision |