Gene name |
SPCC1902.02 |
Gene ID |
26/F02 |
Gene synonyms/obsolete |
SPCC663.16c |
Gene product |
conserved protein;
putative ketopantoate reductase |
Entry clone |
Cloned |
ORF length (unspliced) |
1904 |
ORF length (spliced) |
1725 |
Entry clone length |
1904 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
945A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1902.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAAGAAGATACATC |
Rev primer name |
SPCC1902.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTCCATCCTACGATGCACC |
Amino acid length |
574 |
Molecular weight |
62.8 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots;
periphery at site of septum formation; faint filamentous
structures |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |