Gene name |
SPAC16.04 |
Gene ID |
26/F01 |
Gene synonyms/obsolete |
|
Gene product |
dihydrouridine
synthase; involved in tRNA modification |
Entry clone |
Cloned |
ORF length (unspliced) |
1902 |
ORF length (spliced) |
1854 |
Entry clone length |
1902 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
86T:C / 1719A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC16.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAATTGGAGACTGG |
Rev primer name |
SPAC16.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCTCTGCCTCTTCCACA |
Amino acid length |
617 |
Molecular weight |
69.6 |
Isoelectric point (calc.) |
7.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
22 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; one nuclear
dot |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |