| Gene name |
SPAC15E1.04 |
| Gene ID |
26/D03 |
| Gene synonyms/obsolete |
|
| Gene product |
thymidylate synthase;
flavoprotein; involved in deoxyribonucleotide biosynthesis
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1878 |
| ORF length (spliced) |
|
| Entry clone length |
1878 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
93T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC15E1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACAACCTTTGCATGC |
| Rev primer name |
SPAC15E1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACACTCATTTTCATTTTA |
| Amino acid length |
625 |
| Molecular weight |
69.8 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAQVISTLKL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
bright dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |