| Gene name |
SPAC1A6.03c |
| Gene ID |
26/D01 |
| Gene synonyms/obsolete |
|
| Gene product |
lysophospholipase;
similar to Sp SPAC1A6.04C and SPBC1348.10C SPAC977.09C and
SPCC1450.09C and SPAC1786.02; tandem duplication; GPI anchored
protein (pers. comm. Birgit Eisenhaber) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1875 |
| ORF length (spliced) |
|
| Entry clone length |
1875 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
587A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1A6.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACCGGGCATGCATGA |
| Rev primer name |
SPAC1A6.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATAGTAACGAAACTGTT |
| Amino acid length |
624 |
| Molecular weight |
68.7 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |