Gene name |
SPAC23H3.14 |
Gene ID |
25/E03 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1584 |
ORF length (spliced) |
1410 |
Entry clone length |
1584 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
205A:G / 1342A:T /
1564T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23H3.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAAAATGGTGCAAG |
Rev primer name |
SPAC23H3.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACAGCAGGTTCTTTAGAA |
Amino acid length |
469 |
Molecular weight |
53.1 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVLLKVLLL |
Localization (YFP) |
site of septum
formation; cytoplasmic dots, especially at cell tip |
Comments for localization |
aggregates at cell tip
and site of septum formation by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |