| Gene name |
SPAC23C4.10 |
| Gene ID |
25/E02 |
| Gene synonyms/obsolete |
sec2 |
| Gene product |
guanine nucleotide
exchange factor; coiled-coil domain is essential for function
in Sc SEC2; involved in intracellular protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1584 |
| ORF length (spliced) |
|
| Entry clone length |
1584 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
352T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C4.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTGATGTCTCAAATGT |
| Rev primer name |
SPAC23C4.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCTTCTAATTCTTTTGCA |
| Amino acid length |
527 |
| Molecular weight |
59 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKLFRDLLI |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
probably actin
cytoskeleton |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |