Gene name |
SPAC23C4.10 |
Gene ID |
25/E02 |
Gene synonyms/obsolete |
sec2 |
Gene product |
guanine nucleotide
exchange factor; coiled-coil domain is essential for function
in Sc SEC2; involved in intracellular protein transport |
Entry clone |
Cloned |
ORF length (unspliced) |
1584 |
ORF length (spliced) |
|
Entry clone length |
1584 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
352T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23C4.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTGATGTCTCAAATGT |
Rev primer name |
SPAC23C4.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCTTCTAATTCTTTTGCA |
Amino acid length |
527 |
Molecular weight |
59 |
Isoelectric point (calc.) |
7.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKLFRDLLI |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
Comments for localization |
probably actin
cytoskeleton |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |