| Gene name |
SPCC1529.01 |
| Gene ID |
25/B08 |
| Gene synonyms/obsolete |
SPCC794.14 |
| Gene product |
MFS multidrug efflux
transporter |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1552 |
| ORF length (spliced) |
1389 |
| Entry clone length |
1552 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1529.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCTAGAAAAGAAACC |
| Rev primer name |
SPCC1529.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAACATACATAAATGCC |
| Amino acid length |
462 |
| Molecular weight |
51.8 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEHIPRLKL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |