Gene name |
SPBC30D10.15 |
Gene ID |
25/B07 |
Gene synonyms/obsolete |
|
Gene product |
nuclear assembly
factor; involved in snoRNP biogenesis; complexed with
Shq1p |
Entry clone |
Cloned# |
ORF length (unspliced) |
1551 |
ORF length (spliced) |
|
Entry clone length |
1551 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC30D10.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATCCGCATCTCCCTTG |
Rev primer name |
SPBC30D10.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTCTATAAGAGTCAGAA |
Amino acid length |
516 |
Molecular weight |
57.6 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
378/377 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPCKIPGLSL |
Localization (YFP) |
nuclear envelope;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |