| Gene name |
SPAC4H3.10c |
| Gene ID |
24/H01 |
| Gene synonyms/obsolete |
pyk1 |
| Gene product |
14-3-3 protein;
involved in DNA repair; involved in DNA damage checkpoint;
similar to Sp rad24; involved in cell wall organization and
biogenesis (maintenance); involved in cytokinesis; mutant is
hypersensitive to spindle poison N-3-chlorophenyl carbamate;
negatively regulates Byr2p by affecting its localization;
(0ld-> pyruvate kinase (EC 2.7.1.40)) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1530 |
| ORF length (spliced) |
|
| Entry clone length |
1530 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
81T:C / 488A:G /
701T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4H3.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTCTTCTGCTGTCTC |
| Rev primer name |
SPAC4H3.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCGGCAACGGTAAGACGG |
| Amino acid length |
509 |
| Molecular weight |
55.5 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |