Gene name |
SPAC8C9.03 |
Gene ID |
24/D06 |
Gene synonyms/obsolete |
cgs1; rak1 |
Gene product |
cAMP-dependent protein
kinase; negative regulator of meiosis; mutant (cgs1-1)
displays cAPK activity unregulated by cyclic AMP (cAMP);
(old-> cAMP-dependent protein kinase regulatory
chain) |
Entry clone |
Cloned# |
ORF length (unspliced) |
1504 |
ORF length (spliced) |
1239 |
Entry clone length |
1504 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC8C9.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTCGAAGAAGTATA |
Rev primer name |
SPAC8C9.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCTTTAGTTGATGGAGGT |
Amino acid length |
412 |
Molecular weight |
46.4 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |