| Gene name |
SPAC3A11.12c |
| Gene ID |
24/D01 |
| Gene synonyms/obsolete |
rpt5; pam2; tbp1;
SPAC3H5.01 |
| Gene product |
19S proteasome
regulatory subunit; AAA family ATPase; switch from mitotic to
meiotic cell cycle is disturbed by strong activation of
Ras-MAP kinase cascade in the fission yeast 26S
proteasome-related mutants; (old-> probable 26S protease
regulatory subunit 6A.) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1502 |
| ORF length (spliced) |
1317 |
| Entry clone length |
1502 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1299A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAACTCTCGAAGAATT |
| Rev primer name |
SPAC3A11.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAAAGTATTGCAGAGTC |
| Amino acid length |
438 |
| Molecular weight |
48.8 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |