Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPCC794.10
Gene ID 24/C12
Gene synonyms/obsolete
Gene product UTP-glucose-1-phosphate uridylyltransferase activity; involved in protein amino acid glycosylation; similar to Sp@SPCC1322.04 (paralog); (old-> putative UTP-glucose-1-phosphate)
Entry clone Cloned
ORF length (unspliced) 1500
ORF length (spliced)
Entry clone length 1500
No. of intron 0
Sequence status Finished
Sequence results 1429C:T
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPCC794.10.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGTTGCATCGTCGAATTCA
Rev primer name SPCC794.10.Rv
Rev primer SEQ AGAAAGCTGGGTAACACTCCATTATTTTACAA
Amino acid length 499
Molecular weight 56.7
Isoelectric point (calc.) 6.3
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) none
Localization (YFP) nucleus>cytosol
Comments for localization
Effect of LMB on protein localization no change
Microscope used for observation Confocal

Image information
YFP 1 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.