| Gene name |
SPBC947.12 |
| Gene ID |
23/H09 |
| Gene synonyms/obsolete |
kms2 |
| Gene product |
predicted coiled-coil;
similar to Sp kms1, a protein required for the formation of
meiotic prophase-specific nuclear architecture |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1483 |
| ORF length (spliced) |
1374 |
| Entry clone length |
1483 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
767A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC947.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAATACATCCCTTT |
| Rev primer name |
SPBC947.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTCGGAGACCAACGATTG |
| Amino acid length |
457 |
| Molecular weight |
53.2 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEKVAHLQL/LRVLFFSLLFI |
| Localization (YFP) |
cytoplasmic dots;
periphery; ER? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |