| Gene name |
SPBC1685.06 |
| Gene ID |
23/H08 |
| Gene synonyms/obsolete |
cid11 |
| Gene product |
cid1-related;
nucleotidyltransferase; DNA polymerase kappa; caffeine induced
death protein; similar to Sp SPAC821.04c and cid1 (paralogs);
no apparent Sc ortholog; deletion mutant sensitive to
caffeine; deletion mutant sensitive to HU |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1483 |
| ORF length (spliced) |
1437 |
| Entry clone length |
1483 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
276A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1685.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTTATTGACATTTAC |
| Rev primer name |
SPBC1685.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTCCGGACGCAGGATTT |
| Amino acid length |
478 |
| Molecular weight |
54.5 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |