Gene name |
SPAC27E2.05 |
Gene ID |
23/B11 |
Gene synonyms/obsolete |
cdc1; mis1 |
Gene product |
DNA polymerase delta
(small subunit); interacts physically with Cdc27p; interacts
physically with Pol3p; involved in DNA replication (required);
involved in cell cycle progression (required); involved in
telomere maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
1438 |
ORF length (spliced) |
1389 |
Entry clone length |
1438 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
339A:G / 1323T:C /
1340A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC27E2.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGAAGTCAGACATTC |
Rev primer name |
SPAC27E2.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAGTAATTGGAGTCTCT |
Amino acid length |
462 |
Molecular weight |
51.3 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |