| Gene name |
SPBC2A9.11c |
| Gene ID |
22/G03 |
| Gene synonyms/obsolete |
SPBC2D10.01c |
| Gene product |
conserved eukaryotic
protein; involved in nuclear export; SAC3/GANp family |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
1306 |
| ORF length (spliced) |
1188 |
| Entry clone length |
1306 |
| No. of intron |
2 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC2A9.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAAAGAACATCATAG |
| Rev primer name |
SPBC2A9.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATTTGGCCTTTAATATCA |
| Amino acid length |
395 |
| Molecular weight |
46.2 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
75 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPVLKQTLEL |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |