Gene name |
SPBC354.01 |
Gene ID |
22/G02 |
Gene synonyms/obsolete |
gtp1; SPBC649.06 |
Gene product |
GTP-binding protein;
GTP1/OBG family; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1305 |
ORF length (spliced) |
1092 |
Entry clone length |
1305 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC354.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTGTCTTAGAAAAAGT |
Rev primer name |
SPBC354.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTGTCACAATAGTAACC |
Amino acid length |
363 |
Molecular weight |
40.7 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKERIWEELNL |
Localization (YFP) |
nucleus>cytosol;
microtubules; spindle microtubules |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |