Gene name |
SPBC1347.12 |
Gene ID |
22/D07 |
Gene synonyms/obsolete |
|
Gene product |
actin-like protein;
centractin-like; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1291 |
ORF length (spliced) |
1140 |
Entry clone length |
1291 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1347.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTACTGAAATGTG |
Rev primer name |
SPBC1347.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATCTTCGCCTAAAAATT |
Amino acid length |
379 |
Molecular weight |
42.7 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSFSLQPVLAL/LSTFRRLLI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|