Gene name |
SPBC3B9.14c |
Gene ID |
22/D06 |
Gene synonyms/obsolete |
|
Gene product |
mitochondrial
ribosomal protein L3; RNAse3 domain; ds-RNA binding
motif |
Entry clone |
Cloned |
ORF length (unspliced) |
1291 |
ORF length (spliced) |
981 |
Entry clone length |
1291 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
977A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3B9.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTTTATAAGCAGATC |
Rev primer name |
SPBC3B9.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATTACAAGTTGGCCGTGA |
Amino acid length |
326 |
Molecular weight |
37.1 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSRLCKRLSL |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|