| Gene name |
SPAC890.02c |
| Gene ID |
21/H06 |
| Gene synonyms/obsolete |
alp7; mai1 |
| Gene product |
TACC homolog;
coiled-coil predicted; non-essential; deletion mutant results
in astral microtubule diminishment; deletion mutant results in
short metaphase spindles; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1425 |
| ORF length (spliced) |
|
| Entry clone length |
1425 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
298A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC890.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGATATCGTTTCGAG |
| Rev primer name |
SPAC890.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATTTTTGCTCCAAATTC |
| Amino acid length |
474 |
| Molecular weight |
53.1 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIQMSEDLVI |
| Localization (YFP) |
dots on microtubules;
SPB |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle as dots |
| Microscope used for
observation |
DeltaVision |