| Gene name |
SPAC19D5.03 |
| Gene ID |
21/H05 |
| Gene synonyms/obsolete |
cid1 |
| Gene product |
nucleotidyltransferase; poly(A) polymerase; involved
in S/M checkpoint control (required when polymerase delta or
epsilon inactivated); caffeine induced death protein; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1423 |
| ORF length (spliced) |
1218 |
| Entry clone length |
1423 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
158A:G / 1121T:C /
1291T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19D5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACATTTCTTCTGCACA |
| Rev primer name |
SPAC19D5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAGAATTGTCACCATCG |
| Amino acid length |
405 |
| Molecular weight |
46.2 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |