| Gene name |
SPAC6F6.12 |
| Gene ID |
21/B04 |
| Gene synonyms/obsolete |
|
| Gene product |
sorting nexin;
involved in proteasome function; similar to Sp SPBC1711.11; PX
domain; phosphoinositide binding; involved in intracellular
protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1362 |
| ORF length (spliced) |
1206 |
| Entry clone length |
1362 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
314T:C / 668A:G /
1131T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F6.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGATTCTGTGAATTT |
| Rev primer name |
SPAC6F6.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGCTTAACACGTATCCAA |
| Amino acid length |
401 |
| Molecular weight |
46.3 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEGSIQKLLRL |
| Localization (YFP) |
Golgi |
| Comments for localization |
large cytoplasmic dots
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |