| Gene name |
SPAC56F8.16 |
| Gene ID |
19/H01 |
| Gene synonyms/obsolete |
esc1 |
| Gene product |
transcription factor;
involved in sexual differentiation; basic helix-loop-helix
(bHLH); DNA-binding protein |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1242 |
| ORF length (spliced) |
|
| Entry clone length |
1242 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
326A:T/ 341C:T/
929A:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC56F8.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCATACGCTCTTCC |
| Rev primer name |
SPAC56F8.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGTTCCCTTAGTCACCTCC |
| Amino acid length |
413 |
| Molecular weight |
44.7 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
343 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFDDLKDALPL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |