| Gene name |
SPAC31A2.11c |
| Gene ID |
19/G01 |
| Gene synonyms/obsolete |
cuf1 |
| Gene product |
Cu metalloregulatory
transcription factor; involved in iron homeostasis; copper
fist; DNA-binding domain; regulates copper transporter gene
expression through an Ace1/Amt1-like recognition sequence;
similar to Sp SPCC584.02; functionally complements Sc
MAC1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1236 |
| ORF length (spliced) |
|
| Entry clone length |
1236 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31A2.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGTAATCAATAACGT |
| Rev primer name |
SPAC31A2.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTGAACCTGTTGTAATA |
| Amino acid length |
411 |
| Molecular weight |
45.4 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |