Gene name |
SPAC31A2.15c |
Gene ID |
19/B01 |
Gene synonyms/obsolete |
|
Gene product |
replication factor C
complex; involved in sister chromatid cohesion |
Entry clone |
Cloned |
ORF length (unspliced) |
1196 |
ORF length (spliced) |
1050 |
Entry clone length |
1196 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
14A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31A2.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGCGAATGAAGAAAG |
Rev primer name |
SPAC31A2.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATATAAGAGCTTCAACTCT |
Amino acid length |
349 |
Molecular weight |
40.9 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVPLLKRLTI/LRAALPVVLMI/LIAGLTELAL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |