| Gene name |
SPBC56F2.05c |
| Gene ID |
19/A12 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain; similar to N. crassa 3H10.90; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1194 |
| ORF length (spliced) |
|
| Entry clone length |
1194 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC56F2.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTGCATAGCATTTT |
| Rev primer name |
SPBC56F2.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCTTTGTTTTCGGCCTA |
| Amino acid length |
397 |
| Molecular weight |
42.1 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |