| Gene name |
SPAC23C11.14 |
| Gene ID |
18/D05 |
| Gene synonyms/obsolete |
zhf1; zhf |
| Gene product |
CDF metal cation
transporter; involved in metal homeostasis; involved in zinc
homeostasis; involved in cadmium homeostasis (independent of
the phytochelatin detoxification pathway); involved in cobalt
homeostasis; histidine rich cytoplasmic loop |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1164 |
| ORF length (spliced) |
|
| Entry clone length |
1164 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
949T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C11.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCGACCTCGCAAGACA |
| Rev primer name |
SPAC23C11.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGACGAGGAACCTTGGTCA |
| Amino acid length |
387 |
| Molecular weight |
42.9 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMFFVGSLGL |
| Localization (YFP) |
Golgi; vacuole
membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |