Gene name |
SPAC3F10.10c |
Gene ID |
17/B12 |
Gene synonyms/obsolete |
map3 |
Gene product |
pheromone M-factor
receptor; involved in meiosis (initiation); G-protein coupled
receptor |
Entry clone |
Cloned |
ORF length (unspliced) |
1098 |
ORF length (spliced) |
|
Entry clone length |
1098 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
528C:T / 774G:C /
861T:C / 975A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3F10.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGCCTATTGGGATTTT |
Rev primer name |
SPAC3F10.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACATATTTGGCGGCGTCT |
Amino acid length |
365 |
Molecular weight |
42.4 |
Isoelectric point (calc.) |
8.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLLFWLTL/LSILLPLII |
Localization (YFP) |
nuclear envelope?;
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal;
DeltaVision |