Gene name |
SPAC644.14c |
Gene ID |
17/B11 |
Gene synonyms/obsolete |
rad51; rhp51 |
Gene product |
RecA-like protein;
involved in DNA repair; interacts physically with Rad22p;
involved in meiotic recombination; involved in meiotic gene
conversion (required); AAA family ATPase; helix-hairpin-helix;
DNA-binding protein; telomere binding; involved telomere
maintenance (in the absence of Ku) (required); AAA family
ATPase |
Entry clone |
Cloned |
ORF length (unspliced) |
1098 |
ORF length (spliced) |
|
Entry clone length |
1098 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC644.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATACAGAGGTGGA |
Rev primer name |
SPAC644.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACAGGTGCGATAATTTCC |
Amino acid length |
365 |
Molecular weight |
39.8 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots; nuclear
envelope; nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |