| Gene name |
SPBC839.11c |
| Gene ID |
13/G09 |
| Gene synonyms/obsolete |
hut1 |
| Gene product |
protein which
maintains optimal environment for folding in secretory pathway
proteins in the ER; uridine diphosphate-N-acetylglucosamine
transporter; functional homolog of Sc HUT |
| Entry clone |
Cloned |
| ORF length (unspliced) |
969 |
| ORF length (spliced) |
|
| Entry clone length |
969 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
check |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC839.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGGCTTTATGCGACA |
| Rev primer name |
SPBC839.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATGCCTTTTTTTTCGCA |
| Amino acid length |
322 |
| Molecular weight |
35.9 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGILLVFLGI |
| Localization (YFP) |
ER |
| Comments for localization |
vesicles during spore
formation |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |