Gene name |
SPBC839.11c |
Gene ID |
13/G09 |
Gene synonyms/obsolete |
hut1 |
Gene product |
protein which
maintains optimal environment for folding in secretory pathway
proteins in the ER; uridine diphosphate-N-acetylglucosamine
transporter; functional homolog of Sc HUT |
Entry clone |
Cloned |
ORF length (unspliced) |
969 |
ORF length (spliced) |
|
Entry clone length |
969 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
check |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC839.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGGCTTTATGCGACA |
Rev primer name |
SPBC839.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGATGCCTTTTTTTTCGCA |
Amino acid length |
322 |
Molecular weight |
35.9 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
8 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGILLVFLGI |
Localization (YFP) |
ER |
Comments for localization |
vesicles during spore
formation |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |