Gene name |
SPBC3H7.07c |
Gene ID |
13/G08 |
Gene synonyms/obsolete |
|
Gene product |
phosphoserine
phosphatase; involved in synthesis of serine from
3-phosphoglycerate; involved in serine biosynthesis;
phosphoserine phosphatase activity |
Entry clone |
Cloned |
ORF length (unspliced) |
968 |
ORF length (spliced) |
897 |
Entry clone length |
968 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3H7.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCAACGCAGCCATAGT |
Rev primer name |
SPBC3H7.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTTTGTTTTCCAATAGC |
Amino acid length |
298 |
Molecular weight |
32.4 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSLQNALYL |
Localization (YFP) |
no apparent signal
|
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |