| Gene name |
SPAC18B11.07c |
| Gene ID |
11/F12 |
| Gene synonyms/obsolete |
ubc2; rhp6 |
| Gene product |
ubiquitin conjugating
enzyme; functional ortholog of Sc RAD6; involved in DNA
repair; involved in chromatin remodelling; required for
caffeine-mediated override of checkpoint controls; involved in
the regulation of transcriptional silencing of
heterochromatin; involved in transcriptional silencing of the
mating-type region; overexpression derepressed transcriptional
silencing of the mating-type region; possibly involved in
ubiquitination of histone H2B |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
869 |
| ORF length (spliced) |
456 |
| Entry clone length |
869 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC18B11.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAACGACCGCAAGAAG |
| Rev primer name |
SPAC18B11.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTTCCCAGGAGTCTTCT |
| Amino acid length |
151 |
| Molecular weight |
17 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |