| Gene name |
SPBC2A9.08c |
| Gene ID |
11/F01 |
| Gene synonyms/obsolete |
sec22 |
| Gene product |
the synaptobrevin
family; 1 v-SNARE coiled-coil homology domain;1 longin domain;
required for transport from the ER to the Golgi complex (By
similarity) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
865 |
| ORF length (spliced) |
630 |
| Entry clone length |
865 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2A9.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAAAATTATTTCGTGA |
| Rev primer name |
SPBC2A9.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGAAAAAACGCCAATAG |
| Amino acid length |
209 |
| Molecular weight |
24.4 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |