Gene name |
SPAC17G8.10c |
Gene ID |
10/B10 |
Gene synonyms/obsolete |
dma1 |
Gene product |
spindle assembly
checkpoint component; required to prevent septum formation if
spindle function is compromised; required to prevent premature
exit from mitosis if spindle function is compromised; zinc
finger protein; zf-C3HC4 type (RING finger); ubiquitin ligase
(E3); FHA domain (phosphopeptide binding); involved in
cytokinesis (regulation); involved in septation (regulation);
possibly prevents mitotic exit and cytokinesis during spindle
checkpoint arrest by inhibiting SIN signalling;
non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
804 |
ORF length (spliced) |
|
Entry clone length |
804 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
328T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17G8.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAAAATCTGTTGAGGG |
Rev primer name |
SPAC17G8.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCAGATGCATCGTCTTTT |
Amino acid length |
267 |
Molecular weight |
30.5 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; periphery at
site of septum formation; SPB? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|