Gene name |
SPAC5H10.09c |
Gene ID |
10/B09 |
Gene synonyms/obsolete |
|
Gene product |
3-methyl-2-oxobutanoate hydroxymethyltransferase;
involved in pantothenate biosynthesis (first step); possibly
coexpressed with SPAC5H10.08c which is also involved in
pantothenate biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
804 |
ORF length (spliced) |
|
Entry clone length |
804 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
657T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC5H10.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTAAAGCAAATAAC |
Rev primer name |
SPAC5H10.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGGAAACTGTGTTCTTCA |
Amino acid length |
267 |
Molecular weight |
29.1 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|