Gene name |
SPCC24B10.17 |
Gene ID |
10/A11 |
Gene synonyms/obsolete |
|
Gene product |
emp24 family;
COPII-coated vesicle component; predicted N-terminal signal
sequence; 2 predicted transmembrane helices; involved in cargo
sorting |
Entry clone |
Cloned |
ORF length (unspliced) |
796 |
ORF length (spliced) |
600 |
Entry clone length |
796 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
574T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC24B10.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTTTTTTAACGTATT |
Rev primer name |
SPCC24B10.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACAACACGCTTTACTTCG |
Amino acid length |
199 |
Molecular weight |
23.1 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|