Gene name |
SPAC1B3.07c |
Gene ID |
09/B01 |
Gene synonyms/obsolete |
vps28 |
Gene product |
involved in
intracellular protein transport; involved in protein-membrane
targeting; involved in protein-vacuolar targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
747 |
ORF length (spliced) |
|
Entry clone length |
747 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1B3.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGAATACTACGATCT |
Rev primer name |
SPAC1B3.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAACAAGCTATAGCACTCT |
Amino acid length |
248 |
Molecular weight |
28.1 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |