Gene name |
SPAC31G5.05c |
Gene ID |
08/G07 |
Gene synonyms/obsolete |
|
Gene product |
ribulose phosphate
3-epimerase; involved in pentose-phosphate shunt,
non-oxidative branch |
Entry clone |
Cloned |
ORF length (unspliced) |
732 |
ORF length (spliced) |
687 |
Entry clone length |
732 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
25T:A / 79T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31G5.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTACAGGCAAAAATTGC |
Rev primer name |
SPAC31G5.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAAACCAAGGTTTGGTT |
Amino acid length |
228 |
Molecular weight |
25.2 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNVEVDGGLSL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |