Gene name |
SPAC23H4.07c |
Gene ID |
08/G06 |
Gene synonyms/obsolete |
srp102 |
Gene product |
GTP-binding protein;
involved in intracellular protein transport; involved in
protein-ER targeting; involved in SRP-dependent
cotranslational membrane targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
732 |
ORF length (spliced) |
684 |
Entry clone length |
732 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
83T:C / 274T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23H4.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGGAACTTCTCAAGC |
Rev primer name |
SPAC23H4.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGTAAAGCTGATTCCATC |
Amino acid length |
227 |
Molecular weight |
25.6 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |