| Gene name |
SPCC1450.03 |
| Gene ID |
08/F01 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned in 2004
trial/#check (not sequenced before) |
| ORF length (unspliced) |
723 |
| ORF length (spliced) |
|
| Entry clone length |
723 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1450.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGCCACAACCGGTAA |
| Rev primer name |
SPCC1450.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCGAGATTTGCGACTAGTT |
| Amino acid length |
240 |
| Molecular weight |
27 |
| Isoelectric point (calc.) |
3.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LINMQPSLAI |
| Localization (YFP) |
nucleus>>cytosol; SPB? |
| Comments for localization |
interphase SPB? |
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol;
SPB?) |
| Microscope used for
observation |
DeltaVision |