| Gene name |
SPAC22A12.12c |
| Gene ID |
08/E12 |
| Gene synonyms/obsolete |
|
| Gene product |
exosome (RNase
complex); involved in rRNA processing |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
723 |
| ORF length (spliced) |
|
| Entry clone length |
723 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC22A12.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGAAGTTGAAGAAAA |
| Rev primer name |
SPAC22A12.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAGCTTTTTAATAAGGTCT |
| Amino acid length |
240 |
| Molecular weight |
26.7 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Zeiss |