| Gene name |
SPBC2A9.05c |
| Gene ID |
08/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
Sc YDR084C is possibly involved in vesicular transport
(2-hybrid) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
721 |
| ORF length (spliced) |
660 |
| Entry clone length |
721 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2A9.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCACCTCTTTGGATCG |
| Rev primer name |
SPBC2A9.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAATAAATCTCTTGATA |
| Amino acid length |
219 |
| Molecular weight |
25.2 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYPFIWIILGI |
| Localization (YFP) |
ER; Golgi? |
| Comments for localization |
ER-Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |