| Gene name |
SPBC16G5.11c |
| Gene ID |
06/D09 |
| Gene synonyms/obsolete |
bag101; bag1;
bag1-a |
| Gene product |
BAG-family; chaperone
regulator-1A; ubiquitin family protein; similar to Sp
SPBC530.03c; YIL016W does not have N-terminal ubiquitin
domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
588 |
| ORF length (spliced) |
|
| Entry clone length |
588 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16G5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAAAGACTAGCAC |
| Rev primer name |
SPBC16G5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCGGCCACTTCTTGGCTT |
| Amino acid length |
195 |
| Molecular weight |
22.2 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |