| Gene name |
SPBC1773.02c |
| Gene ID |
06/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
thioredoxin
peroxidase; AhpC/TSA family; involved in regulation of redox
homeostasis; involved in response to oxidative stress;
antioxidant activity; involved in de-repression of telomeric
silencing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
588 |
| ORF length (spliced) |
|
| Entry clone length |
588 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
109G:A / 334G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1773.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGCCCCCAGAAGATC |
| Rev primer name |
SPBC1773.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTTCAGAATCAGTGATT |
| Amino acid length |
195 |
| Molecular weight |
21.1 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |