| Gene name |
SPAC30C2.05 |
| Gene ID |
05/H05 |
| Gene synonyms/obsolete |
erv14 |
| Gene product |
cornichon family; 3
predicted transmembrane helices; predicted N-terminal signal
sequence; involved in intracellular protein transport;
ER-derived vesicle protein; involved in intracellular protein
transport; involved in ER to Golgi transport; COPII-coated
vesicle associated; similar to Sp SPAC2C4.05 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
562 |
| ORF length (spliced) |
426 |
| Entry clone length |
562 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30C2.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTGTAAGTTGGGG |
| Rev primer name |
SPAC30C2.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTTCTTGAATTAAGGAC |
| Amino acid length |
141 |
| Molecular weight |
16.6 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLFLANLPL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |