Gene name |
SPAC6B12.13 |
Gene ID |
05/E02 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
Sc YFR003C may physically interact with Glc7p and Ppz1p; Sc
YFR003C is null lethal |
Entry clone |
Cloned |
ORF length (unspliced) |
540 |
ORF length (spliced) |
315 |
Entry clone length |
540 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6B12.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACTCACAAGACCGTT |
Rev primer name |
SPAC6B12.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCGCGTTCATATGCATTG |
Amino acid length |
104 |
Molecular weight |
11.6 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |