Gene name |
SPCC23B6.05c |
Gene ID |
04/D10 |
Gene synonyms/obsolete |
ssb3; rpa3 |
Gene product |
replication factor-A
(subunit 3); ssDNA-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
479 |
ORF length (spliced) |
315 |
Entry clone length |
479 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC23B6.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACGCCCTACACCTCG |
Rev primer name |
SPCC23B6.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCAAAAAAAAGTGAGTTA |
Amino acid length |
104 |
Molecular weight |
11.7 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |