Gene name |
SPAC23C4.13 |
Gene ID |
03/G12 |
Gene synonyms/obsolete |
bet1 |
Gene product |
SNARE; BET1 family; 1
t-SNARE coiled-coil homology domain; 1 predicted transmembrane
helix; required for vesicular transport from the ER to the
Golgi complex. Functions as a SNARE associated with ER-derived
vesicles (By similarity). |
Entry clone |
Cloned# |
ORF length (unspliced) |
446 |
ORF length (spliced) |
354 |
Entry clone length |
446 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23C4.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATCAAGGTATGTACT |
Rev primer name |
SPAC23C4.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATCTTACCAAAACGAGG |
Amino acid length |
117 |
Molecular weight |
13.2 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; Golgi; vacuole
membrane |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |